HDR Template Design
Template Types
code
ssODN (single-stranded oligodeoxynucleotide): - Length: 100-200nt total - Homology arms: 30-60nt each side - Best for: Small insertions (<50bp), point mutations - Delivery: Electroporation with RNP dsDNA (double-stranded DNA): - Length: 500bp - 5kb total - Homology arms: 200-800bp each side - Best for: Larger insertions (tags, reporters) - Delivery: Plasmid or PCR product Plasmid donor: - Homology arms: 500-2000bp - Best for: Large insertions (>1kb), conditional alleles - Delivery: Transfection
ssODN Design
python
from Bio.Seq import Seq
def design_ssodn(target_seq, cut_site, insert_seq='', arm_length=50):
'''Design single-stranded oligo donor for HDR
Args:
target_seq: Genomic sequence around cut site
cut_site: Position of Cas9 cut (3bp upstream of PAM)
insert_seq: Sequence to insert (empty for deletion/mutation)
arm_length: Length of each homology arm (30-60nt optimal)
ssODN considerations:
- Total length should be 100-200nt (synthesis limit)
- Asymmetric arms can improve HDR (PAM-distal shorter)
- Strand choice: complementary to non-target strand often better
'''
# Extract homology arms
left_arm = target_seq[cut_site - arm_length:cut_site]
right_arm = target_seq[cut_site:cut_site + arm_length]
# Assemble ssODN
ssodn = left_arm + insert_seq + right_arm
# Also provide reverse complement (may work better)
ssodn_rc = str(Seq(ssodn).reverse_complement())
return {
'sense': ssodn,
'antisense': ssodn_rc,
'length': len(ssodn),
'left_arm_length': len(left_arm),
'right_arm_length': len(right_arm),
'insert_length': len(insert_seq)
}
def design_ssodn_mutation(target_seq, mutation_pos, new_base, arm_length=50):
'''Design ssODN for a point mutation
For point mutations, center the mutation in the ssODN.
Also introduce silent PAM mutation to prevent re-cutting.
'''
# Build mutant sequence
mutant = list(target_seq)
mutant[mutation_pos] = new_base
mutant_seq = ''.join(mutant)
# Extract arms around mutation
left_start = mutation_pos - arm_length
right_end = mutation_pos + arm_length + 1
ssodn = mutant_seq[left_start:right_end]
return {
'sequence': ssodn,
'length': len(ssodn),
'mutation_position_in_ssodn': arm_length,
'original_base': target_seq[mutation_pos],
'new_base': new_base
}
Asymmetric Arm Design
python
def design_asymmetric_ssodn(target_seq, cut_site, insert_seq, pam_position):
'''Design ssODN with asymmetric homology arms
Asymmetric arms can improve HDR efficiency:
- PAM-proximal arm: 30-40nt (shorter)
- PAM-distal arm: 60-90nt (longer)
The longer arm is on the side that gets resected first.
'''
# Determine which side is PAM-proximal
if pam_position > cut_site: # PAM is to the right
left_arm_length = 70 # PAM-distal (longer)
right_arm_length = 35 # PAM-proximal (shorter)
else: # PAM is to the left
left_arm_length = 35
right_arm_length = 70
left_arm = target_seq[cut_site - left_arm_length:cut_site]
right_arm = target_seq[cut_site:cut_site + right_arm_length]
ssodn = left_arm + insert_seq + right_arm
return {
'sequence': ssodn,
'length': len(ssodn),
'left_arm_length': left_arm_length,
'right_arm_length': right_arm_length,
'asymmetry': 'PAM-distal longer'
}
dsDNA Donor Design
python
def design_dsdna_donor(target_seq, cut_site, insert_seq, arm_length=500):
'''Design double-stranded DNA donor for larger insertions
Args:
target_seq: Extended genomic sequence (need ~2kb around cut)
cut_site: Position of Cas9 cut
insert_seq: Sequence to insert (tag, reporter, etc.)
arm_length: Homology arm length (200-800bp recommended)
For PCR amplification, returns primer sequences for arms.
'''
left_arm = target_seq[cut_site - arm_length:cut_site]
right_arm = target_seq[cut_site:cut_site + arm_length]
donor = left_arm + insert_seq + right_arm
return {
'sequence': donor,
'length': len(donor),
'left_arm': left_arm,
'right_arm': right_arm,
'insert': insert_seq
}
def design_pcr_primers_for_donor(left_arm, right_arm, insert_seq, tm_target=60):
'''Design PCR primers to amplify HDR donor
Creates primers for Gibson assembly or overlap PCR.
'''
# Forward primer: 5' end of left arm
fwd_primer = left_arm[:20]
# Reverse primer: 3' end of right arm (reverse complement)
rev_primer = str(Seq(right_arm[-20:]).reverse_complement())
# Overlap primers for Gibson assembly
# Left arm reverse with insert overhang
left_overlap = str(Seq(left_arm[-20:]).reverse_complement()) + insert_seq[:15]
# Right arm forward with insert overhang
right_overlap = insert_seq[-15:] + right_arm[:20]
return {
'left_arm_fwd': fwd_primer,
'left_arm_rev': left_overlap,
'right_arm_fwd': right_overlap,
'right_arm_rev': rev_primer
}
Common Insertions
python
# Common tag sequences for knock-ins
TAGS = {
'FLAG': 'GATTACAAGGATGACGATGACAAG',
'3xFLAG': 'GATTACAAGGATGACGATGACAAGGATTACAAGGATGACGATGACAAGGATTACAAGGATGACGATGACAAG',
'HA': 'TACCCATACGATGTTCCAGATTACGCT',
'V5': 'GGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACG',
'MYC': 'GAACAAAAACTCATCTCAGAAGAGGATCTG',
'6xHIS': 'CATCACCATCACCATCAC',
'GFP_LINKER': 'GGCGGAGGCGGAAGC', # Flexible linker before GFP
}
def design_tag_insertion(target_seq, cut_site, tag_name, position='C-term'):
'''Design HDR donor for protein tagging
Args:
position: 'N-term' or 'C-term' relative to target gene
For C-terminal tagging, insert before stop codon.
For N-terminal tagging, insert after start codon.
'''
tag_seq = TAGS.get(tag_name, tag_name) # Use custom if not in dict
# Add linker if needed
if position == 'C-term':
insert = TAGS['GFP_LINKER'] + tag_seq # Linker before tag
else:
insert = tag_seq + TAGS['GFP_LINKER'] # Tag then linker
return design_ssodn(target_seq, cut_site, insert)
PAM Mutation to Prevent Re-cutting
python
def add_silent_pam_mutation(donor_seq, pam_position, codon_table='standard'):
'''Add silent mutation to disrupt PAM in donor
After HDR, the PAM should be disrupted to prevent Cas9
from cutting the edited allele.
Strategy:
- If PAM (NGG) is in coding region, make synonymous change
- Change GG to GA, GC, or GT (no longer recognized)
- Ensure the mutation is synonymous (silent)
'''
donor = list(donor_seq)
# NGG PAM - mutate second G to A (most common silent option)
if pam_position + 2 < len(donor):
if donor[pam_position + 1:pam_position + 3] == ['G', 'G']:
# Try GG -> GA (often silent in 3rd codon position)
donor[pam_position + 2] = 'A'
return ''.join(donor)
Related Skills
- •genome-engineering/grna-design - Design guide to create cut site
- •primer-design/primer-basics - PCR primer design for cloning
- •sequence-io/read-sequences - Read and parse GenBank features